Processing Bio-Rad ddSEQ single cell data

Background

Bio-Rad provides ddSEQ Single-Cell 3’ RNA-seq and ddSEQ Single-Cell ATAC-seq kits. This document outlines using the auto-process-ngs pipeline to perform Fastq generation and QC for these data.

Requirements

No additional external software is required for the Fastq generation or QC.

Fastq generation

The biorad_ddseq Fastq generation protocol should be used for Bio-Rad’s ddSEQ Single-Cell RNA-Seq and ATAC-seq data when running the make_fastqs command.

Analysis project setup and QC

Once Fastqs have been successfully generated, the SC_platform and Library metadata items should be set to the appropriate values for the Parse Evercode project(s) in the projects.info control file.

The following values are valid options:

Platform	Library type
`Bio-Rad ddSEQ Single Cell 3' RNA-Seq`	`scRNA-seq`
`Bio-Rad ddSEQ Single Cell 3' RNA-Seq`	`snRNA-seq`
`Bio-Rad ddSEQ Single Cell ATAC`	`scATAC-seq`
`Bio-Rad ddSEQ Single Cell ATAC`	`snATAC-seq`

Running the setup_analysis_dirs command will automatically transfer these values into the project metadata on creation. The run_qc command will then determine the appropriate QC protocol to use based on the metadata values.

Appendix: position of DNA insert sequences for QC (ddSEQ ATAC)

The Bio-Rad SureCell ATAC library configuration for R1 reads is assumed to look like:

7bp barcode
0-4bp “phase block”
Fixed sequence TATGCATGAC (10bp)
7bp barcode
Fixed sequence AGTCACTGAG (10bp)
7bp barcode
Fixed sequence TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG (33bp)
DNA insert (remainder of the sequence, 40-44bp)

The DNA insert in any individual read sequence is therefore expected to start between positions 75 and 79 (depending on the size of the variable length phase block sequence).

For the R2 reads it is assumed to look like:

DNA insert (40bp)
6bp TI adapter

Based on this, for the BioRad_ddSEQ_ATAC QC protocol the mapped metrics are calculated using R1 positions 79-118 and all of R2.